doi: 10.3752/cjai.2015.28
http://zoobank.org/References/1360ED3A-8330-43BD-B051-2DDBBBD76AA0
Most specimens in collections were reared from sections of conifer boles as described in Spradbery and Kirk (1978). Some specimens were captured on stumps or boles, trapped using Lindgren funnel and cross-vane traps, collected at forest fires in western North America, or captured on hilltops with short vegetations.
Rearing from conifer boles is most effective in gathering males and females of Xeris with tree host information. A siricid survey was done across Europe, Turkey and North Africa by Spradbery and Kirk (1978); about 4000 specimens of Xeris were collected. In summary, they located dead, dying, or damaged conifers, searched for round siricid emergence holes, dead or live ovipositing siricid females or their parasitoids, and woodpecker damage. Using an axe, they checked the bole of each tree by cutting small disks for evidence of frass-packed galleries made by siricid larvae, live siricid larvae, and characteristic brown stains from the siricid symbiotic fungus, Amylosterum sp. Attacked boles were sent to an insectary, organized by locality and tree specimen in coded bins, and emerged specimens were preserved and labelled with the tree name, collection date, and other pertinent information.
Images were made using a range of image capture systems: MZ16 Leica binocular microscope and an attached Leica DFC420. Some specimens were photographed using DSLR Canon Rebel Xti and T2i cameras with a 100 mm macro and MPE-65 lens. Multiple images through a range of focal planes from top to bottom were taken of a structure and these combined using Combine ZM or ZP (Hadley, 2010), or Zerene to produce a single, focused image. Specimens were illuminated with a 13 watt daylight fluorescent lamp or flash through a semi-transparent plastic surface and reflected with a matt aluminum surface. The final combined image was improved using Adobe Photoshop® 7, CS4 or CS6, and plates were assembled using the same software. Corel Draw® 9.0 was used to generate barcode trees.
Characters under the “MALE. Description” are in addition to those given under the “FEMALE. Description” excluding those of the “Cornus”, the “Sheath” and the “Ovipositor”
Methods for DNA studies
Adult horntails were collected by hand, in traps or by rearing from numerous locations in North America and around the world. Larvae were mostly intercepted over the last 30–40 years at ports in woody packing material and sent to the USDA Systematic Entomology Laboratory, Washington DC, for identification to family. All specimens were stored in alcohol, although some were trapped in a different liquid and then transferred to ethanol, and either sent to the Center for Bottomland Hardwoods Research in Stoneville, MS, or for most specimens from the Canadian National Collection, Ottawa, to the Biodiversity Institute of Ontario for sequencing. DNA barcode (CO1) sequences were generated in Mississippi using the extraction, amplification and sequencing protocols of Schiff et al. (2012) or in Guelph by the standard protocols detailed by Fernandez –Triana et al. (1979). Most Mississippi samples were sequenced using oligo’s LCO 1490 and HCO 2198 (Folmer et al. 1994) but in a few cases HCO 2198 was paired with a novel oligo WES1 (5’GGCTTTTCTCTACTAATCATAAGGATATTGG 3’). Most Ottawa samples were sequenced in Guelph using primers LepF1 and LepR1 but some of the more degraded samples were sequenced in pieces using the oligo pairs (LepF1, RonMWASPdeg_t1) and (LepR1, C_ANTMR1D) see BOLDSYSTEMS primer database at http://www.boldsystems.org/index.php/Public_Primer_PrimerSearch. Analysis was performed using DNAStar by Lasergene. Sequences for each specimen were combined into individual specimen contigs using Seqman, aligned by Clustal V and used to construct a Neighbor-Joining, tree (Saitou and Nei 1987) in DNAStar Megalign. Bootstrap values were calculated from 1000 trials and a random seed of 111. A single representative sequence for each taxon was used to generate an approximate table of pair distances between species also using Megalign.
| Table of contents | Abstract | Introduction | Materials and Methods | Biology | Hosts | Parasitoids | Morphology | Key | DNA | References | Citation | Appendices | PDFs |
